Abstract
The DNA sequence, d(AGGGAGGGCGCTGGGAGGAGGG), occurs within the promoter region of the c-kit oncogene. We show here, using a combination of NMR, circular dichroism, and melting temperature measurements, that this sequence forms a four-stranded quadruplex structure under physiological conditions. Variations in the sequences that intervene between the guanine tracts have been examined, and surprisingly, none of these modified sequences forms a quadruplex arrangement under these conditions. This suggests that the occurrence of quadruplex-forming sequences within the human and other genomes is less than was hitherto expected. The c-kit quadruplex may be a new target for therapeutic intervention in cancers where there is elevated expression of the c-kit gene.
| Original language | English |
|---|---|
| Pages (from-to) | 10584-9 |
| Number of pages | 6 |
| Journal | Journal of the American Chemical Society |
| Volume | 127 |
| Issue number | 30 |
| DOIs | |
| Publication status | Published - 2005 |
Fingerprint
Dive into the research topics of 'Putative DNA quadruplex formation within the human c-kit oncogene'. Together they form a unique fingerprint.Cite this
- APA
- Author
- BIBTEX
- Harvard
- Standard
- RIS
- Vancouver